• Українська
  • English

< | >

Current issue   Ukr. J. Phys. 2016, Vol. 61, N 6, p.516-518
http://dx.doi.org/10.15407/ujpe61.06.0516    Paper

Kudrya V.Yu.1, Yashchuk V.M.1, Dubey I.Ya.2, Kovalyuk K.I.1, Batsmanova O.I.1, Mel'nik V.I.3, Klishevich G.V.3, Naumenko A.P.1, Kudrya Yu.M.1

1 Faculty of Physics, Taras Shevchenko National University of Kyiv
(2, Prosp. Academician Glushkov, Kyiv 03022, Ukraine; e-mail: vladkudrya@ukr.net)
2 Institute of Molecular Biology and Genetics, Nat. Acad. of Sci. of Ukraine
(150, Zabolotnogo Str., Kyiv 03680, Ukraine)
3 Institute of Physics, Nat. Acad. of Sci. of Ukraine
(46, Prosp. Nauky, Kyiv 03028, Ukraine)

The Spectral Properties of the Telomere Fragments

Section: Soft Matter
Original Author's Text: English

Abstract: The optical absorption and phosphorescence (at low temperatures) of a telomere fragment (oligonucleotide d(AGGGTTAGGGTTAGGGTTAGGG)) and (for comparing) the DNA macromolecule are investigated under various excitation wavelengths (240–300 nm). Two types of d(AGGGTTAGGGTTAGGGTTAGGG) samples were studied: (1) the intact sample, and (2) the sample heated to 90C and studied immediately after heating. It is concluded that the main traps of triplet electronic excitations in both these samples of d(AGGGTTAGGGTTAGGGTTAGGG), as well as DNA, are the complexes formed by neighbor adenine (A) and thymine (T) chromophores from the same strand (not from complementary chromophores of the different strands).

Key words: optical absorption, phosphorescence, adenine chromophore, thymine chromophore, oligonucleotide d(AGGGTTAGGGTTAGGGTTAGGG).

References:

  1. V. Yashchuk, V. Kudrya, M. Losytskyy, H. Suga, and T. Ohul'chanskyy, J. of Mol. Liq. 127, 79 (2006).   CrossRef
  2. V.M. Yashchuk, V.Yu. Kudrya, M.Yu. Losytskyy, I.Ya. Dubey, and H. Suga, Mol. Cryst. Liq. Cryst. 467, 311 (2007).   CrossRef
  3. V.Yu. Kudrya, V.M. Yashchuk, Ukr. J. Phys. 57, 187 (2012).
  4. M. Armanios and E.H. Blackburn, Nature Rev. Genet. 13, 693 (2012).   CrossRef   PubMed   PubMedC
  5. A.T. Phan and J.-L. Mergny, Nucl. Acids Res. 30, 4618 (2002).   CrossRef   PubMed   PubMedC
  6. . R.D. Gray, J.B. Chaires, Nucl. Acids Res. 36, 4191 (2008).   CrossRef   PubMed>   PubMedC